CONFERENCIA
GENERALIDADES SOBRE EL MATERIAL GENÉTICO


Sumario

El tamaño, secuencia y complejidad del DNA
Estructura secundaria del DNA
Estructura terciaria y superhelicidad
Estructura de la cromatina
El DNA extracromosómico
Enzimas auxiliares en procesos que involucran DNA superenrrollado


El tamaño secuencia y complejidad del DNA

Las moléculas de DNA son generalmente enormes. Su peso molecular es difícil de determinar porque su tamaño de 106 a 1010 hace difícil obtener moléculas intactas. Los PM de muchos DNAs se conocen (Tabla 2.4 Adams). Se suele describir su tamaño en términos de pares de kilobases (kb) más que daltons. Un millón de PM corresponde aproximadamente a 1.5 kb. La forma extremadamente alargada del duplex de DNA junto a su rigidez lo hace muy susceptible al daño mecánico fuera del ambiente de protección de la célula, las fuerzas hidrodinámicas que se generan por manipulaciones como la agitación y pipeteo rompen el DNA en pedazos relativamente pequeños, así que el aislamiento de una molécula intacta de DNA requiere de manipulación cuidadosa.

Los genes se encuentran en los cromosomas. En las bacterias existe un solo cromosoma por célula y en casi todos los casos existe 1 copia de cualquier gen dado (unos pocos genes como los rRNAs están repetidos varias veces). El gen es secuencia de DNA o RNA, esencial para una función específica cuyo desarrollo puede no requerir que se traduzca o transcriba. Existen 3 tipos de genes: (1) los c
odificadores de proteínas, (2) los que especifican RNA y (3) los genes reguladores. Los dos primeros tipos constituyen los genes estructurales. En el tercer grupo muchas veces solo se incluyen los genes que no se transcriben.

La organización de los genes en los eucarióticos es estructural y funcionalmente más compleja. En el genoma eucariótico se encuentra 3 tipos de secuencias de DNA, cuya proporción varía ampliamente entre los distintos organismos:

Copia única o DNA no repetitivo: Esta es la visión clásica de un gen estructural. Se presenta en la cantidad de 1 ó 2 copias por genoma haploide y constituye el componente más abundante del genoma eucariótico (es el único en el procariótico). Dentro de este grupo se encuentran los genes que codifican proteínas y los que codifican RNA.

Moderadamente repetitivo: Son longitudes de hasta pocos cientos de pares de bases que se repiten al menos 1000 veces. Dentro de los genes moderadamente repetitivos se encuentran los que codifican para algunas proteínas como histonas, las globulinas y también los que codifican para moléculas de RNA ribosómico. No siempre son los genes que codifican productos abundantes, los que se encuentran repetidos.

Altamente repetitivo: El DNA repetitivo que no codifica proteínas ni RNA. Estas secuencias altamente repetidas se les llama DNA satélite porque su composición de bases no usual permite su separación del resto del DNA, así el DNA de ratón se separa en dos grandes bandas por centrifugación en gradiente de densidad de CsCl, una de ellas corresponde al DNA satelite:

cuando las muestras de DNA celular son fragmentadas. Este DNA se asocia con dos estructuras importantes: el centrómero y el telómero del cromosoma. El centrómero es un punto de unión para proteínas que liga el cromosoma a los microtúbulos del uso mitótico, los telómeros ayudan a estabilizar el cromosoma.

La cantidad total de DNA en el genoma (haploide) es característico de cada especie viviente y existe una gran variación en este valor, la siguiente tabla muestra la talla del genoma para diferentes organismos en pb:

Además existe un incremento del tamaño del genoma a medida que este se hace más complejo, este gráfico muestra el rango de valores para el tamaño del genoma haploide correspondientes a diferentes grupos de organismos:

Otra característica del genoma eucariótico es que la mayor parte de ellos está constituido por genes interrumpidos. La parte del genoma eucariótico que codifica se llama exón y las zonas de DNA entre ellos intrón. Los intrones son mucho más largos que los exones. La figura siguiente representa abreviadamente la expresión de genes interrumpidos:

Así se ha encontrado que sólo el 2 % del DNA de los mamíferos codifica proteínas. El DNA de procariontes es muy compacto y está dedicado en su mayor parte a codificar proteínas. El genoma humano es aproximadamente mil veces mayor que el de E.coli, pero el número de genes es probablemente sólo cincuenta veces mayor, en vez, de serlo mil veces. Un reto actual de la Biología Molecular es descifrar la función de más de 3000 millones de pb en el genoma humano, que no codifican ni proteínas ni RNAs.

El DNA altamente repetitivo

En el ratón el DNA satélite se localizó por hibridación in situ. Se inmovilizaron las células bajo una capa de agar y se trataron con álcali para desnaturalizar el DNA. Esta preparación se incubó con RNA marcado con titrio, transcrito in vitro, utilizando como molde DNA satélite purificado de ratón. Los híbridos de este RNA radioactivo y las regiones cromosómicas que contenían DNA satélites fueron detectados por autorradiografía. Se obtuvo como resultado que casi todo el DNA satélite está localizado en los centrómeros, los lugares de unión de los husos mitóticos, como se observa en la siguiente microfotografía:

Será interesante estudiar el papel de este DNA satélite, que se repite más de 10 000 veces y que comprende el 5 % del cromosoma. Además se encuentran localizados en la heterocromatina. Este DNA se conoce como VNTR (Variable Number Tandem Repeat). Se produce por recombinación entre miembros de una familia de minisatélites o deslizamiento durante la replicación. Esto da como resultado que diferentes personas tengan diferente número de copias del minisatélite y esta es la fuente de heterocigosidad que puede ser usada para análisis de pedigrí y pruebas de paternidad.

Hay 2 tipos de repeticiones de acuerdo a la longitud de las secuencias repetidas. Las secuencias repetidas en tandem que van desde 6 a 100 pares de bases conocidas como minisatélites; mostrando un polimorfismo alto que es la clave para los análisis fingerprint, que es una herramienta poderosa en estudios de poblaciones, determinación de paternidad, medicina forense, y otras. La otra clase de VNTRs, son los microsatélites o también SSRs (simples secuencias repetitivas), STRs (del inglés, Short Tandem Repeats), que son secuencias repetitivas con pocos pares de bases, lo cual no está muy claro, ya que existen diferencias entre investigadores acerca del número de pares de bases que forman las repeticiones, pero en general van desde 1-6 pb. Una característica muy especial es que son altamente polimórficas. Los microsatélites están siendo muy utilizados como marcadores moleculares, fundamentalmente.

Las repeticiones también pueden ser clasificadas de la siguiente forma:

SINES (Short interspersed repeats), repeticiones entremezcladas cortas de 100-500 pb.
LINES (Long interspersed repeats), repeticiones entremezcladas largas de varios Kb.

En el genoma humano las secuencias Alu son SINES especialmente abundantes. Estas secuencias de 300 bp se repiten aproximadamente un millón de veces en el genoma humano. De hecho, la mayor parte de los fragmentos de DNA humano de 20 Kb contienen una secuencia Alu (el nombre procede de la endonucleasa de restricción AluI, que corta a muchas de estas secuencias). El grado de identidad secuencial entre cualquier par de miembros de esta familia es de aproximadamente el 85 %. Un hallazgo intrigante es que las secuencias Alu son similares al 7SL RNA, la molécula de RNA citoplasmático implicada en las partícula de reconocimiento de señales. Se pudieron originar por transcripción inversa de los 7SL RNA y por integración de este cDNA en el genoma. De hecho, parece ser que la mayoría de los SINES han surgido a partir de genes que codifican pequeños RNAs citosólicos, como tRNAs y el 7SL RNA. Las funciones de los SINES y LINES son un enigma. Algún DNA repetitivo puede ser DNA chatarra, vestigios de alguna función ya eliminada a través de la evolución, o puede constituir materia prima para que esta actúe.


El tamaño secuencia y complejidad del DNA


La estructura covalente del DNA deriva en una extraordinaria versatilidad de estructuras secundarias. La siguiente tabla muestra una comparación entre los tres tipos más importantes de DNA duplohelicoidal:

Parámetro
DNA A
DNA B
DNA Z
Tipo de hélice
La más ancha
Intermedia
La más larga
Sentido de giro
Dextrógiro
Dextrógiro
Levógiro
Diámetro de la hélice
26 A
20 A
18 A
Altura por pb
2.6 A
3.4 A
3.7 A
pb/vuelta
11
10
12 (6 dímeros)
Long. de una vuelta de la hélice
25.3 A
34 A
45 A
Inclinación de los pares de bases respecto al plano normal al eje de la hélice
20°
Surco mayor
Estrecho y muy profundo
Ancho y bastante profundo
Plano
Surco menor
Muy amplio y poco profundo
Estrecho y bastante profundo
Muy estrecho y profundo
Plegamiento del azúcar
C3'-endo
C2'-endo
C2'-endo Pyr
C3'-endo Pur
Enlace glicosídico
Anti
Anti
Anti Pyr
Syn Pur

La conformación B, propuesta por Watson & Crick en 1953, se asume cuando el contraión es un metal como el Na+, humedad relativa de 92 %. Algunas de sus características son:

1- Dos cadenas polinucleotídicas enrolladas a la derecha formando una doble hélice de 20 A de diámetro. Las dos cadenas son antiparalelas y están envueltas una con otra de tal forma que no se pueden separar sin desenrrollar la hélice (arrollamiento plectonémico). Las bases están ubicadas en el interior, mientras que las cadenas de fosfato y azúcar están en la periferia, de tal modo que minimizan las repulsiones entre los grupos fosfatos cargados.

2- Los planos de las bases casi perpendiculares al eje de la hélice. Cada base unida por puente de H a la base en la cadena opuesta para formar un par de bases planar, fenómeno que resulta en la asociación específica de las dos cadenas en la doble hélice.

3- La hélice ideal de B-DNA tiene 10 pb por vuelta (un giro de hélice de 360 por pb) y ya que las bases aromáticas tienen un grosor de 3.4 Å y están parcialmente apiladas una sobre otra, la hélice tiene un paso de rosca (aumento por vuelta) de 34 Å. Lo mas sobresaliente es que se pueden acomodar sobre dos tipos de pb: A con T y viceversa, cada G con C y viceversa. La geometría de estos pares de bases se llama pares de Watson-Crick (W-C). Ambos pb son intercambiables en el sentido de que se pueden reemplazar una por otra en la doble hélice sin alterar las posiciones del esquema azúcar-fosfato en el C-1´. Sin embargo, cualquier otra combinación de bases distorsiona la doble hélice, ya que la formación de un par de base no W-C requiere una reorientación de la cadena azúcar-fosfato.

El DNA-B tiene dos surcos exteriores profundos que se enrrollan entre sus cadenas de azúcar-fosfato como una consecuencia de que el eje de la hélice pasa a través del centro aproximado de cada pb. Los surcos son de diferente tamaño porque el borde de arriba de cada pb es diferente estructuralmente del de abajo y los residuos de desoxiribosa están asimétricos, en el surco menor hay un ángulo C´- eje hélice C´ menor de 180°, mientras que en el surco mayor el ángulo C´- eje hélice C´mayor de 180°.

El eje de hélice pasa por el medio de cada pb. Cualquier secuencia es posible si la cadena opuesta tiene una secuencia complementaria, lo que explica las reglas de Chargaff y sugiere que la información hereditaria es codificada en la secuencia de bases de cada cadena.

Desviaciones del DNA real del modelo de Watson-Crick

El aumento por residuos, el número de residuos por vuelta y los grados de enrrollamiento son aproximadamente iguales al DNA-B ideal. No obstante, los residuos individuales se separan significativamente de esta conformación promedio de una manera que parece depender de la secuencia. Los estudios por difracción de Rayos X y NMR de numerosos oligómeros duplehelicoidales han demostrado que la conformación del DNA es irregular, siendo específica de secuencia, aunque las reglas que especifican como la secuencia gobierna la conformación han probado ser sorprendentemente difíciles de determinar.

En el modelo W-C (10 residuos/vuelta), cada residuo se relaciona con su contiguo de la cadena por una rotación de 360°. En el dodecámero de Dickerson (d CGCGAATTCGCG va de 28° a 42°), el ángulo de rotación oscila de 28°-42°. Otra desviación del modelo es una rotación opuesta de las dos bases de cada pareja sobre su eje longitudinal. Esta característica estructural llamada Torsión del Propulsor o Alabeo permite el empaquetamiento de las bases. Otra fuente de variabilidad es el balanceo que es la rotación del mejor plano medio de la Purina y la Pirimidina alrededor del eje mayor del par.

Cuando la humedad relativa se reduce al 75 % el DNA-B sufre un cambio conformacional reversible a la llamada forma A. los estudios de fibras por Rayos X indican que una forma de DNA-A es una hélice dextrogira más ancha y aplanada que la B. Tiene 11 pb /vuelta, un aumento por vuelta de 25.3 A, lo cual da a esta forma un hueco axial. La característica que mas llama la atención es que los planos de sus pb están inclinados 20° con respecto al eje de la hélice. Si el eje de la hélice no pasa a través de sus pares de bases esta forma tiene un profundo surco mayor y un surco menor muy plano. Puede ser descrito como una cinta plana enrollada alrededor de un cilindro hueco de 6 A de diámetro. La mayoría de los oligonucleótidos autocomplementarios de menos de 10 pb, por Ej d(GGCCGGCC) y d(GGTATACC) cristalizan en la forma DNA-A. En el DNA-B estas moléculas exhiben considerable variación conformacional específica de la secuencia. El DNA-A ha sido observado hasta ahora en esporas de las bacterias Gram -, en unas proteínas pequeñas solubles en ácido (Small acid-soluble spore proteins).

Alrededor de 25 años después del descubrimiento de la estructura de Watson y Crick, la determinación de la estructura del cristal de d(CGCGCG) por Wang y Rich reveló de forma sorprendente una doble hélice levógira. Una hélice similar se formaba por d(CGCATGCG). Esta hélice se ha llamado DNA Z, tiene 12 pb por vuelta, un aumento por vuelta de 45 A y en contraste con el DNA-A, un profundo surco menor y un surco mayor imperceptible, la molécula se parece a la barrena de un taladro. Los pb en ella están girados 1800 relativos a aquellos del DNA-B a través de los cambios conformacionales que discutiremos cuando analicemos la conformación del esqueleto azúcar-fosfato. Como una consecuencia, la unidad que se repite es un dinucleótido d(XpYp), más que un solo nucleótido como en las otras hélices. La línea que une los grupos fosfatos sigue un zig-zag alrededor de la hélice, más que una curva suave como en el resto de las conformaciones.

La difracción de fibras y los estudios de NMR han mostrado que los poli d(GC), poli d(CG), poli d(AC) y poli d(GT) toman esta conformación a altas concentraciones de sales. Es decir, esta conformación se asume mas fácilmente por segmentos con secuencias de bases en que se alternen Pu-Py, por causa de la conformación del esqueleto azúcar-fosfato. Una alta concentración de sal estabiliza el DNA Z en relación al B, reduciendo la repulsión electrostática entre los grupos fosfatos más cercanos sobre cadenas opuestas (8 A en Z vs 12 A en B). La metilación de residuos de C en C5, una modificación biológica común, también promueve la forma Z, ya que un grupo metilo hidrofóbico en esta posición está menos expuesto al solvente en la forma Z que en la B.

Con relación al significado biológico del DNA Z, Rich ha propuesto que la conversión reversible de segmentos específicos de DNA-B a DNA-Z bajo circunstancias apropiadas actúa como una especie de interruptor en la regulación de la expresión genética. Todavía la existencia in vivo ha sido difícil de probar. Recientemente, sin embargo se ha demostrado la presencia de DNA-Z en E. Coli, empleando una enzima que metila una secuencia específica de bases in vivo cuando el DNA está en la forma B, pero no cuando está en la forma Z. Se le atribuyen papeles aún no definidos en la regulación de la expresión de algunos genes o en la recombinación genética. La metilación in vivo de esta secuencia de bases es inhibida cuando la misma se clona en E. coli dentro o adyacente un segmento de DNA que pueda formar DNA Z. Además hay un balance entre las formas DNA B y Z in vivo de estos DNAs que se piensa que está influenciada por factores ambientales tales como concentración de sales y proteínas que se unen al DNA. No obstante la función biológica del DNA Z permanece aún oscura.

Existe otra estructura llamada DNA C, que se produce a partir del DNA-B en presencia de soluciones de sales concentradas y etilén glicol (sal de litio y 6 % de humedad relativa).

pb/vuelta: 9.33
Aumento por pb: 31 A
Inclinación con respecto a la horizontal: 6°

Conformación del RNA 11 o híbridos RNA-DNA

Muchos tipos de RNAs, por ejemplo de transferencia y ribosomal, contienen secuencias complementarias que forman fragmentos de doble hélice. Estas estructuras duplohelicoidales son incapaces de asumir una conformación como la presente en el DNA-B, por causa del impedimento estérico de su grupo 2´OH. estas estructuras asumen una conformación similar al DNA-A, conocida como RNA-A o RNA-11 (por tener 11 pb por vuelta). La inclinación de los pb respecto al plano normal al eje de la hélice es de aproximadamente 14°.

La doble hélice híbrida DNA-RNA también se piensa que tienen conformación A. Se estudió por Rich la estructura por Rayos X del oliginucleótido r(GCG)d(TATACCC) y el oligonucleótido complementario d(GGGTATACGC). Se encontró una hélice tipo A con 11 pb/vuelta. Aunque la geometría del apareamiento de bases aquellas del segmento central "TATA" está distorsionada. No hay indicación de una transición desde un tipo de hélice A a uno B en la unión entre el híbrido y el DNA duplex (los duplex de DNA de menos de 10 pb tienden a cristalizar en forma A).

Otras estructuras

Los palindromes son secuencias de bases con simetría doble sobre las 2 cadenas. Todas son autocomplementarias dentro de las hebras:

TTAGCACGTGCTAA
AATCGTGCACGATT

Cuando una secuencia de bases es seguida por una secuencia complementaria cercana en la misma molécula la cadena se pliega y genera un duplex antiparalelo llamado horquilla, que consiste de una región de doble hélice apareada, el tallo con un lazo de bases no apareadas en un extremo. Si el DNA es de doble cadena se genera una estructura cruciforme.

En el caso del espejo repetido la secuencia invertida se encuentra dentro de cada cadena individual:

TTAGCAC CACGATT
AATCGTG GTGCTAA

Existe otra estructura particularmente poco usual que se le conoce también como DNA-H que se forma en tramos de polipirimidinas / polipurinas que también incorporan una repetición en espejo dentro de la secuencia. Un ejemplo simple es un largo tramo de residuos de T y C como se muestra a continuación:

5' … GGAGAGGTCTCTCTCTCTCTCTCT ....
3' ... CCTGTCCAGAGAGAGAGAGAGAGA ....
5' ... GTCTCTCTCTCTCTCTCT ....

Una característica novedosa de este apareamiento es que involucra 3 cadenas de DNA para formar una triple hélice. Esta hélice triple se forma espontáneamente solo dentro de largas secuencias que contienen solamente pirimidinas (o solamente purinas) en una cadena. Dos de las 3 cadenas en el DNA-H contiene pirimidinas y la tercera contiene purinas.

Estas variaciones estructurales son interesantes porque hay una tendencia para que muchas de ellas aparezcan en sitios donde se inician o regulan, eventos importantes del metabolismo del DNA (replicación, recombinación, transcripción). Ej, los sitios reconocidos por muchas secuencias específicas para la unión de proteínas son organizados en palíndromes y la secuencias que pueden formar H-DNA se encuentran dentro de regiones involucradas en la regulación de la expresión de algunos genes eucarióticos.

Otro tipo de variación estructural lo constituyen las curvaturas que se producen cuando 4 o mas residuos de Adenina aparecen secuencialmente en una de las dos cadenas. 6 A en hilera producen una curvatura de casi 18º .


Superhelicidad y topología del DNA


El DNA celular debe estar muy compactado para que pueda estar contenido en la célula, lo que implica un alto grado de organización estructural, pero el problema no es que se pliegue, sino que este plegamiento pueda permitir en cualquier momento el acceso a la información contenida en él.

El término superenrollamiento significa literalmente enrollar un rollo. El ejemplo típico es lo que ocurre con un cordón telefónico.  El DNA esta enrollado en forma de una doble hélice en torno a un eje, una curvatura de ese eje sobre si mismo da lugar al DNA supenrollado, si no ocurre esto se dice que el DNA esta relajado. El superenrollamiento altera notablemente la forma global del DNA. Una molécula de DNA superenrollada es más compacta que una molécula de DNA relajada de la misma longitud. Por lo tanto el DNA superenrollado se mueve al ser centrifugado o sometido a electroforesis, más rápido que el DNA relajado.

El conocimiento sobre la conformación del DNA está enriquecido por los conceptos elaborados a partir de la topología, una rama de las matemáticas que trata de las propiedades estructurales que no cambian por deformaciones tales como el estiramiento y el plegamiento. El número Lk de enlace (linking) se define como el número de veces que una hebra de DNA cruza la otra:

+ → hacia la derecha
– → hacia la izquierda

El número de giro (T) refleja el enrollamiento helicoidal de las hebras de DNA entre si. El número de superenrollamiento (W) es una medida del enrollamiento del eje de la doble hélice. La topología expresa este fenómeno matemáticamente por:

L = T + W

L es un número entero mientras que T y W no tienen que ser enteros. Una disminución del número entero de enlace provoca un súper enrollamiento dextrógiro (–) del eje de la molécula de DNA y un desenrollamiento del dúplex de W – C. La figura siguiente ayuda a entender el carácter topológico de Lk y geométrico de T y W, en el DNA circular cerrado o estabilizado por proteínas T y W varían para mantener constante Lk, las distintas formas de superenrrollamiento con igual Lk son topológicamente equivalentes:

El grado de superenrollamiento de una molécula de DNA se expresa  en términos de densidad de superenrollamiento (σ), que no depende de la longitud:

donde Lko  es el L de la molécula circular relajada. La densidad de superenrollamiento de la mayor parte de las moléculas de DNA naturales es de aproximadamente de – 0.06. El signo – significa que las superhélices surgen del infraenrollamiento o desenrollamiento. El superenrollamiento negativo prepara al DNA para los procesos de replicación, recombinación y transcripción. El superenrollamiento positivo compactaría al DNA con gran eficacia, pero dificultaría la separación de las hebras. Es la razón poderosa para la selección del superenrollamiento negativo en la naturaleza.

El Lk de un DNA c.c. es siempre un numero entero. Por convenio:

  • El súper arrollamiento negativo (–) se representa con una hélice hacia la derecha.

  • El súper arrollamiento positivo (+) se representa con una hélice hacia la izquierda.

Como el DNA-Z aparece sólo raramente, Lk + no se encuentra en estudios de DNA para propósitos prácticos. Vamos a ampliar estas ideas para un DNA de 210 pb.

¿Si está relajado cuál será Lk?

Lk = 20 = 210/10.5

Si se rompen las cadenas, se desenrollan y se separan, entonces Lk = indefinido. Podemos hablar del superenrollamiento del DNA por cambios en Lk. Si dos vueltas de hélice se eliminan, Lk = 18.  El cambio será, 

ΔLk = Lk – Lko = 18 – 20 = –2.

Se puede presentar el DNA en cualquiera de las dos formas que se muestran. Se expresa a menudo el cambio en el Lk, por una cantidad independiente de la longitud. ΔLk es la diferencia específica en el número de enlace:

para el ejemplo:

Lo que significa que el 10 % de las vueltas de la hélice presentes en el DNA (en forma B) han sido eliminadas. El grado de subarrollamiento en los DNA celulares cae en el rango 5 – 7%, esto es s = –0.05 a  – 0.07. El signo – de σ denota que el cambio en el Lk se produce como resultado del subarrollamiento del DNA.

La superhelicidad (supercoiling) inducida por subarrollamiento (underwinding) es definido como negativo, tiene sentido fisiológico. La superhelicidad (supercoiling) inducida por superarrollamiento (overwinding) se define como positivo, solo se produce in vitro.

La vía tomada por el eje de la hélice en un caso y otro es su imagen en espejo: superhélice  –, Lk = 18; superhélice +, Lk = –22.

El subarrollamiento del DNA facilita un número de cambios estructurales en la molécula:

  • Es crítico en el proceso de replicación y transcripción y representa la mayor razón que determina  que el DNA permanezca en esta estructura subarrollado.
  • Facilita la formación de estructura cruciforme en las sec palindrómicas, al mantener la separación de las hebras requeridas.
  • Facilita la formación de cortas regiones de  hélice levógira en el DNA Z, cuando las secuencias que existen son consistentes con su formación.

Los agentes intercalantes como el bromuro de etidio controlan el superenrollamiento del DNA. Cuando se intercala la molécula de doble hélice se desenrolla. Para mantener T normal 1 vuelta (10.5 pb) W disminuye. Si se continúa añadiendo el bromuro de etidio T disminuye lo que se compensa con un incremento de W, pero en sentido contrario. El círculo pasa a través de 0 (circular relajado), se hace positivo y superenrollado.

La superhelicidad del DNA tiende a hacer este extendido y estrecho mas que compactado y a menudo muestra múltiples ramas. A las densidades de superhélice encontradas en las células la longitud del eje del DNA superhelicado incluyendo sus ramas es >> 40% de la longitud del DNA en si. Este tipo de superhélice se llama plectonémico del griego Pletktos (Torcido) y Nema (Hilo). Torcido sobre si mismo. Esta es la forma que muestra el DNA subenrollado en solución y no da la compactación requerida para su empaquetamiento en la célula. Una segunda forma superhelicoidal es la solenoidal o toroidal (torcido sobre una estructura diferente del DNA, es el que sigue el DNA en las células eucarióticas. Ambas formas se muestran en la figura siguiente:

Estas son dos formas de superhelicidad – que pueden ser tomadas por el mismo DNA subenrollado. Las dos formas son interconvertibles fácilmente, la plectonémica se adopta en solución, la solenoidal se encuentra en la cromatina, proporciona un mejor grado  de compactación.

página siguiente